Rfa1 (Replication Factor A protein 1) as part of the replication protein A (RPA/RP-A), a single-stranded DNA-binding heterotrimeric complex, may play an essential role in DNA replication, recombination and repair. Binds and stabilizes single-stranded DNA intermediates, preventing complementary DNA reannealing and recruiting different proteins involved in DNA metabolism. Binds to single-stranded sequences participating in DNA replication in addition to those mediating transcriptional repression (URS1) and activation (CAR1). Stimulates the activity of a cognate strand exchange protein (SEP1). It cooperates with T-AG and DNA topoisomerase I to unwind template DNA containing the simian virus 40 origin of DNA replication.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, recombinant Rfa1 protein (without a tag) from Saccharomyces cerevisiae, UniProt: P22336
S. cerevisiae Rad 51 protein (400 aa, 43 kDa) is a functional and structural homolog of E.coli RecA and human Rad51 proteins and plays a central role in DNA homologous recombination and recombination repair by promoting homologous DNA strand exchange reaction. Dmcl, Rad55, Rad57 are paralogs of Rad51 and they form complex with Rad51 and Rad52 in mediating recombination processes.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Saccharomyces cerevisiae
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant and HIS tagged RAD51 protein from Saccharomyces cerevisiae, UniProt: P25454
Applications:
ELISA (ELISA), Chromatin immunoprecipitation (ChIP), Immunofluorescence (IF), Immunoprecipitation (IP), Western blot (WB)
Cyclobutane Pyrimidine Dimer photolyase (Deoxyribodipyrimidine photo-lyase) is involved in repair of UV radiation-induced DNA damage. Catalyzes the light-dependent monomerization (300-600 nm) of cyclobutyl pyrimidine dimers (in cis-syn configuration), which are formed between adjacent bases on the same DNA strand upon exposure to ultraviolet radiation. Upon absorption of visible light electrons are transferred from Trp-307 through Trp-360 to Trp 383, and from there to FADH, giving rise to the fully reduced catalytic FADH .
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant DNA photolyase protein from E.coli, UniProt: P00914
Applications:
ELISA (ELISA), Immunoprecipitation (IP), Western blot (WB)
E. coli DNA polymerase 1 (928 aa; 103 kDa) is encoded by polA gene and involved in DNA replication and repair. In addition to polymerase activity, this DNA polymerase exhibits 3' to 5' and 5' to 3' exonuclease activity. It is able to utilize nicked circular duplex DNA as a template and can unwind the parental DNA strand from its template.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Purified, full length, recombinant POL I protein from E.coli, UniProt: P00582
The products of umuD , umuC , and recA genes (SOS genes) are required for mutagenesis induced by radiation or chemical agents. Transcription of these SOS genes is repressed by a repressor, LexA protein in uninduced cells. Exposure of cells to DNA-damaging agents activates RecA protein to promote proteolytic cleavage of LexA protein. Inactivation of LexA protein by the cleavage consequently derepresses the SOS genes, umuD, C and recA . UmuD protein is then auto-cleaved, which is promoted by RecA protein ssDNA in a ATP-dependent manner. The processed UmuD protein is the active form for mutagenesis and the UmuD-UmuC complex functions as an error-prone translesion DNA polymerase.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C and make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Highly purified, full length, recombinant UmuD protein from E.coli, UniProt: P0AG11
Shinagawa et al. (1998). RecA protein-dependent cleavage of UmuD protein and SOS mutagenesis. Proc Natl Acad Sci U S A. 1988 Mar;85(6):1806-10. doi: 10.1073/pnas.85.6.1806. PMID: 3126496; PMCID: PMC279868.
E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvC protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant without a tag at a concentration of 1 mg/ml (determined by BCA method). UniProt: P0A814
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
18,7 | 19 kDa
Selected references:
Shinagawa & Iwasaki (1996). Processing the holliday junction in homologous recombination. Trends Biochem Sci. 1996 Mar;21(3):107-11. PMID: 8882584.Iwasaki et al. (1991) Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure. EMBO J. 1991 Dec;10(13):4381-9. PMID: 1661673; PMCID: PMC453191.
Special application note:
This product can be used in:in vitro functional studies. RuvC cleaves recombination intermediate at Holiday JunctionAs a positive control in Western blot and standard in ELISA.
E. coli RuvC protein is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces nicks at the symmetrical points of the Holliday junction, cleaving and resolving the recombinant.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor 6 monthss, afterwards at -80 C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length, recombinant RuvC protein from E.coli, UniProt: P0A814
Ichiyanagi et al. (1998). Mutational analysis on structure-function relationship of a holliday junction specific endonuclease RuvC. Genes Cells. 1998 Sep;3(9):575-86. doi: 10.1046/j.1365-2443.1998.00213.x. PMID: 9813108.Shinagawa & Iwasaki (1996). Processing the holliday junction in homologous recombination. Trends Biochem Sci. 1996 Mar;21(3):107-11. PMID: 8882584.Saito et al (1995). Identification of four acidic amino acids that constitute the catalytic center of the RuvC Holliday junction resolvase. Proc Natl Acad Sci U S A. 1995 Aug 1;92(16):7470-4. doi: 10.1073/pnas.92.16.7470. PMID: 7638215; PMCID: PMC41361.
E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvB protein is full length, highly purified (over 95 %, SDS-PAGE), recombinant. UniProt: P0A812
Purity:
Contans 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 95 % pure by SDS-PAGE.
Molecular Weight:
37 kDa
Selected references:
Mazina et al. (2012) Polarity and bypass of DNA heterology during branch migration of Holliday junctions by human RAD54, BLM, and RECQ1 proteins. J Biol Chem. 2012 Apr 6;287(15):11820-32. doi: 10.1074/jbc.M112.341347. Epub 2012 Feb 22. PMID: 22356911; PMCID: PMC3320930.Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in:in vitro functional studies. RuvA and RuvB are forming a complex that promotes Holiday junction ( a recombination intermediate) branch-migration by using ATP hydrolysis energy.As a positive control in Western blot and standar in ELISA.
RuvB protein of Escherichia coli forms a complex with RuvA protein and the complex promotes branch migration of Holliday junction at the late stage of homologous recombination and recombination repair. RuvB is a DNA motor protein which possesses the ATPase activity, activated by DNA and RuvA protein. RuvB in the absence of ATP, it predominantly occurs in a monomer form. In the presence of ATP, it forms dimer and hexamer depending upon the concentration. With RuvA and Holliday junction., it forms a double hexamer.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor up to 6 monthss, afterwards at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length, recombinant RuvB protein from E.coli, UniProt: P0A812
RuvA protein of Escherichia coli binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at 4°Cor -20 °C for a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RuvA protein is full length, highly purified (over 90 %, SDS-PAGE). UniProt: P0A809
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22 kDa (monomer)
Selected references:
Han et al. (2006). Direct observation of DNA rotation during branch migration of Holliday junction DNA by Escherichia coli RuvA-RuvB protein complex. Proc Natl Acad Sci U S A. 2006 Aug 1;103(31):11544-8. doi: 10.1073/pnas.0600753103. Epub 2006 Jul 24. PMID: 16864792; PMCID: PMC1544206.Iwasaki et al. (1992) Escherichia coli RuvA and RuvB proteins specifically interact with Holliday junctions and promote branch migration. Genes Dev. 1992 Nov;6(11):2214-20. doi: 10.1101/gad.6.11.2214. PMID: 1427081.
Special application note:
This product can be used in functional studies as Holliday junction specific binding protein, which promotes Holliday-junction branch migration in combination with RuvB protein
RuvA protein of Escherichia coli binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair, and forms a complex with RuvB motor protein, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above, holding it in between
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at 4°Cfor up to 6 monthss, for longer storage-80°Cis recommended; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Purified, full length RuvA protein of Escherichia coli, UniProt: P0A809
E. coli RecA protein is a very important enzyme for homologous recombination and recombinational repair. Its synthesis is induced by SOS response caused by DNA damage. RecA protein has multiple functions such as single stranded DNA dependent ATPase activity, DNA annealing activity, formation of D-loop and Holliday structure in homologous recombination reaction, and coprotease activities that promote self-cleavages of LexA repressor, lambda phage repressor and UmuD protein. RecA protein binds to single and double stranded DNA for nucleofilament formation. It carries out a central role in homologous recombination.
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
RecA protein is full length, highly purified (over 90 %, SDS-PAGE) by several steps of chromatography. Provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7G6
Purity:
Contains 50% glycerol, 20 mM Tris-HCl (pH 8), 1 mM EDTA, 150 mM KCl, 1 mM DTT. Over 90 % pure, by SDS-PAGE
Molecular Weight:
38 kDa
Selected references:
Ishibashi, Oura S & Umemura (2017) Adsorption of DNA binding proteins to functionalized carbon nanotube surfaces with and without DNA wrapping. Eur Biophys J. 2017 Sep;46(6):541-547. doi: 10.1007/s00249-017-1200-3. Epub 2017 Feb 15. PMID: 28204854.Oura et al. (2015) Biomolecular recognition ability of RecA proteins for DNA on single-walled carbon nanotubes. Colloids Surf B Biointerfaces. 2015 Feb 1;126:496-501. doi: 10.1016/j.colsurfb.2015.01.002. Epub 2015 Jan 10. PMID: 25612818.
RecA (Recombinase A) plays critically important roles in homologous recombination, recombination repair and regulation of cellular responses to DNA damage (SOS response). RecA promotes auto-cleavage of LexA repressor by its coprotease activity after DNA damage, and induces many proteins related to DNA repair including RecA itself.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Escherichia coli
Immunogen:
Hihgly purified, full length (352 amino acids) RecA protein of E.coli, UniProt: P0A7G6
Applications:
ELISA (ELISA), Indirect immunofluorescent (IF), Immunoprecipitation (IP), Western blot (WB)
Escherichia coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the S
Product Type:
Antibody
Format:
Liquid
Storage Temp:
Store at -20 °C or -80°Cfor a longer period of time; once make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
LexA protein is full length, highly purified (over 90 %, SDS-PAGE) provided at a concentration of 1 mg/ml estimated by BCA method. UniProt: P0A7C2
Purity:
Contains 50% glycerol, 10 mM Tris-HCl (pH 7,5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. Over 90 % pure by SDS-PAGE.
Molecular Weight:
22,3 | 23 kDa
Special application note:
This product can be used in:Functional studies of E.coli SOS response. This product will bind to SOS box in vitro and repress the expression of the genes belonging to SOS regulationWestern blot as a positive control, to confirm that the bait construct is expressed in yeast two-hybrid sstem using lexA genecontrol in ChIP in combination with anti-LexA antibodies
LexA represor binds specifically to the SOS-box sequence and represses the genes belonging to the SOS regulation. In response to DNA damage, RecA protein is activated by ss-DNA accumulated in the damaged cells and promotes autocleavage of LexA repressor by its coprotease activity. As a result, DNA repair genes and error prone polymerases are induced, and DNA damage is repaired and mutation is induced (1). The lexA gene is used for yeast two-hybrid experiments as a bait to identify the protein-protein interaction in vivo.Alternative names: exrA, spr, tsl, umuA
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Hishida et al (2004) Role of the Escherichia coli RecQ DNA helicase in SOS signaling and genome stabilization at stalled replication forks. Genes Dev. 2004 Aug 1;18(15):1886-97. doi: 10.1101/gad.1223804. PMID: 15289460; PMCID: PMC517408.
Special application note:
This product can be used in:studies of SOS regulation in E.coli detection of bait constructs in yeast two-hybrid systemimmunolocalization of LexA fusion proteins (fixed with 4 % formaldehyde)immunoprecipiation and ChIP
Alternative oxidases (AOX) are quinol oxidases located in the inner mitochondrial membrane of plants. They function as terminal oxidases in the alternate electron transport pathway, oxidizing ubiquinone to reduce oxygen to water.
Product Type:
Antibody
Antibody Type:
Polyclonal
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated synthetic peptide derived from Arabidopsis thaliana AOX2 protein sequence, UniProt: O22049 , TAIR: At5g64210
Cat2 (Catalase 2) is an enzyme which occurs in almost all aerobically respiring organisms and serves to protect cells from the toxic effects of hydrogen peroxide.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
The anti-Myc tag is a primary antibody which is used to detect proteins containing the Myc epitope tag. The Myc tag contains the amino acid sequence EQKLISEEDL, corresponding to amino acids 410-419 of human Myc.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please, remember to spin tubes briefly prior to opening them to avoid any losses that might occur from lyophilized material adhering to the cap or sides of the tubes.
Host Animal:
Rabbit
Species Reactivity:
Myc epitope tag, fused to N- or C-terminal of proteins
Immunogen:
KLH-conjugated synthetic peptide: EQKLISEEDL (Myc tag), derived from UniProt: Q6LBK7
The two Arabidopsis POLLUX-like homologs PEC1 and PEC2 represent plastid envelope membrane cation channels with K + conductivity that are required for the stress triggered Ca 2+ release into the stroma.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Camelina sativa, Capsella rubella, Nicotiana benthamiana, Noccaea caerulescens, Pisum sativum, Raphanus sativus, Species of your interest not listed? Contact us
Immunogen:
The soluble domain 466 (M244 until stop codon, ≈ 64 kDa) was cloned into pET16b and transformed into BLR 21 for 467 expression in Escherichia coli UniProt: Q8VZM7-1, TAIR: At5g02940
V lkner et al (2021) Two plastid POLLUX ion channel-like proteins are required for stress-triggered stromal Ca2+release, Plant Physiology, Volume 187, Issue 4, December 2021, Pages 2110–2125, https://doi.org/10.1093/plphys/kiab424
Special application note:
This antibody is recognizing PEC1, but not PEC2 or DMI1
Strep-tag II is a synthetic peptide consisting of eight amino acids (Trp-Ser-His-Pro-Gln-Phe-Glu-Lys) and this peptide sequence shows high affinity towards Strep-Tactin , a specifically engineered streptavidin, and can be N- or C- terminally fused to recombinant proteins.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Strep-tag II-proteins
Immunogen:
KLH-conjugated synthetic peptide Strep-tag II epitope tag, sequence: ASWSHPQFEKGA
mNeonGreen (Fluorescent Protein) is a new bright monomertic yellow-green fluorescent, with low conservation level to GFP. It has an excitation maximum at 506 nm and an emission maximum at 517 nm and therefore is compatible with the most GFP filter sets. mNeonGreen is 3x brighter compare to GFP, more stable and does not bleach so fast as GFP, which makes it very suitable for confocal and super resolution microscopy, for fusion proteins with low expression levels. It can be used in bicistronic vectors, which will allow simultaneous expression of two proteins separately, from the same RNA transcript. mNeonGreen has MW of 26.6 kDa.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
mNG tag in plant (Arabidopsis thaliana) and algal vectors (Chlamydomonas reinhardtii)
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated peptide derived from synthetic peptide, UniProt: A0A1S4NYF2 from common lancelet Branchiostoma lanceolatum
This antibody is detecting protein sequence of mNG tag in plant and algal vectors.This antibody is also reacting to some degree with YFP and mCherry.
Application Details:
1 g/1ml (IF), 1 : 1000 - 1: 5000 (WB)
Purity:
Immunogen affinity purified serum, in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water.
Molecular Weight:
Depends upon used fusion partner
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known.
Selected references:
To be added when available, antibody available in November 2021.
Special application note:
The peptide used to elicit this antibody is conserved in the following expression vectors: dCas9-P2A-DHFR(TSc3)-T2A-mNeonGreen [Cloning vector pBM020]Cas9-P2A-DHFR(TSc3)-T2A-mNeonGreen [Cloning vector pBM006]mNeonGreen4-tDeg [Cloning vector pminiCMV-mNeonGreen4-tDeg]ER-localized mNEONGREEN [Binary vector pKT-NM-erNEON]mNeonGreen-3xFLAG [Cloning vector pLM160-mNeonGreen]mNeonGreen-ty1 [Cloning vector pSAG1-mNeonGreen_TUB1-dTomato]mNeonGreen, partial [Binary vector pRATIO2131]The peptide used to elicit this antibody is not conserved in GFP protein sequence. Antibody is also recognzing mCheery sequence.
HSP23.5 (Heat shock protein 23.5 (mitochondrial) is involved in plant heat shock response.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
MnSOD3 (Superoxide dismutase) is an chloroplastic enzyme which destroys radicals which are normally produced within the cells and which are toxic to biological systems. It is induced under Fe limitation, Mn Deficiency, and H2O2 stress as shown by Page et al. (2012).
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Chlamydomonas reinhardtii
Expected Species:
green algaeSpecies of your interest not listed? Contact us
Immunogen:
Recombinant MnSOD3 of Chlamydomonas reinhardtii, product of a MSD3 gene Cre16.g676150; Phytozome
Specific extraction method requires to be applied, check as published in Page et al. (2012).MnSOD3 can be only detected in Fe-limited cells (0.5 or 0.2 mM added Fe) (i.e., samples exhibiting the novel MnSOD activity) but not in cells grown with higher concentrations of added Fe.
Application Details:
1: 1000 (WB)
Purity:
Serum
Reconstitution:
For reconstitution add 50 l of sterile water
Molecular Weight:
32 | 35 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Page et al. (2012) Fe sparing and Fe recycling contribute to increased superoxide dismutase capacity in iron-starved Chlamydomonas reinhardtii. Plant Cell. 2012 Jun;24(6):2649-65. doi: 10.1105/tpc.112.098962. Epub 2012 Jun 8. PMID: 22685165; PMCID: PMC3406916.
VSP (Vegetative storage protein 1) may function as somatic storage protein during early seedling development. Expression of VSP1 is enhanced by wounding and protein is localized to vacuole.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Liquid
Storage Temp:
Store at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Species of your interest not listed? Contact us
Immunogen:
Full length, purified recombinant His6-tagged VSP1 of Arabidopsis thaliana UniProt: O49195, TAIR: At5g24780
Reactivity of this antibody to VSP2 has not been determined, Sequence conservation of VSP1 and VSP2 is 86 % therefore, it is most likely that this antibody will also recognize VSP2,
Application Details:
1: 1000 - 1: 2000 (WB)
Purity:
Total IgG, purified on Protein A in PBS, 50 % glycerol, filter sterilized.
Molecular Weight:
28 | 27 kDa
Not reactive in:
No confirmed exceptions from predicted reactivity are currently known
Selected references:
Matsushima et al. (2002). An endoplasmic reticulum-derived structure that is induced under stress conditions in Arabidopsis.Plant Physiol. 2002 Dec;130(4):1807-14. doi: 10.1104/pp.009464.
Arabidopsis thaliana auxin efflux carrier component AtPIN2 encoded by the AtPIN2 gene (also known as EIR1 and AGR1). AtPIN proteins are asymmetrically localized within plant plasma membranes and mediate polar auxin transport. AtPIN2 is a key regulator of the response of Arabidopsis roots to gravity. Alternative names: Auxin efflux carrier AGR, Ethylene-insensitive root 1, AtEIR1, Polar-auxin-transport efflux component AGR1, Protein AGRAVITROPIC 1, AtAGR1, Protein WAVY 6.
Product Type:
Antibody
Antibody Type:
Polyclonal
Format:
Lyophilized
Storage Temp:
Store lyophilized/reconstituted at -20 °C; once reconstituted make aliquots to avoid repeated freeze-thaw cycles. Please remember to spin the tubes briefly prior to opening them to avoid any losses that might occur from material adhering to the cap or sides of the tube.
Host Animal:
Rabbit
Species Reactivity:
Arabidopsis thaliana
Expected Species:
Beta vulgaris, Brassica napus, Camelina sativa, Cannabis sativa, Capsella rubella, Cucumis melo, Eucalyptus grandis, Eutrema salsugineum, Glycine max, Malus domestica, Morus notabilis, Prunus dulcis, Raphanus sativus, Spinacia oleracea, Vitis vinifera Species of your interest not listed? Contact us
Immunogen:
KLH-conjugated mixture of two synthetic peptides derived from AtPIN2 sequence, UniProt:Q9LU77, TAIR:At5g57090
Immunogen affinity purified serum in PBS pH 7.4.!!AIR8!!Immunogen affinity purified serum in PBS pH 7.4.
Reconstitution:
For reconstitution add 50 l, of sterile water
Molecular Weight:
69,3 kDa
Not reactive in:
Lemna minor, Zea mays
Selected references:
To be added when available, antibody available in November 2021.
UniProt number:
UniProt,Q9LU77
TAIR number:
AT5G57090,TAIR
Research area:
Arabidopsis thaliana antibodies
Cookies:
X
We use cookies to help personalise and improve your web experience.
By using our website you consent to our use of cookies, some of which may have already been set on your device.
View our Cookie Policy to learn more.
